So Tedros, this corrupted, lying and highly criminal with his henchmen and backers writes about something that was triggered by these toxic-chemical and poisonous substances and once again pushes fear into the people in order to bring harmful and deadly substances to the people again - hands off all future so-called "vaccinations", which have NEVER been necessary and have ALWAYS been the primary cause of disease and even death, as they enter the organism directly and thus into the blood and are transported with the blood to the individual organs, enter the tissue and are deposited on and in the organs, inflaming and damaging them and even can causing cancer!!!
So if we see this picture here, then THAT is an absolute lie!!!
https://www.thecitizen.co.tz/tanzania/news/east-africa-news/eac-issues-alert-on-spread-of-mpox-4707572
You can see why this is a lie here!
and here is the proof that this so-called "monkey-pox" is triggered by these toxic and poisonous substances!!!
https://www.sciencedirect.com/science/article/pii/S1876034121001878#fig0005
or also here:
https://www.sciencedirect.com/science/article/pii/S0190962221024427
and also read the reference studies, because none of them are rare!!!
And they know it!! Screenshot from summer 2022
And there was also an exercise already in 2021 for THAT to guarantee that all these criminals tell the same lies!!!
https://www.nti.org/wp-content/uploads/2021/11/NTI_Paper_BIO-TTX_Final.pdf
https://web.archive.org/web/20240802204741/https://www.nti.org/wp-content/uploads/2021/11/NTI_Paper_BIO-TTX_Final.pdf
And don't forget to scroll to the last page!!!
And now let's take a look at a so-called "study" from 2022, where you could stop reading at abstract!
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9461308/
But of course, have again a look at a so-called "isolation", which makes the fraud perfect!!
And now let's take a look at the 100% false and fraudulent "PCR-sequences" that go with it and what these Clowns have used!(Reference 13 from the study above)
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9628942/
CACACCGTCTCTTCCACAGA
GATACAGGTTAATTTCCACATCG
AACCCGTCGTAACCAGCAATACATTT
TGTCTACCTGGATACAGAAAGCAA
GGCATCTCCGTTTAATACATTGAT
CCCATATATGCTAAATGTACCGGTACCGGA
GGAAAATGTAAAGACAACGAATACAG
GCTATCACATAATCTGGAAGCGTA
AAGCCGTAATCTATGTTGTCTATCGTGTCC
"PCR tests" are ALWAYS wrong!!!, using designed, synthetic-chemically produced oligonucleotide primers to detect only dead cellular debris, if people were unlucky enough to excrete them and be "tested" at the same time, but also animals and plants excrete them and no matter how many so-called "alignments" are made with a computer softwar/tool, nobody can say where they really come from - in humans THESE can only be dead cell debris, which humans excrete between 50-70 million every day(cell division) to grow and stay healthy.
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__9606__9558&LINK_LOC=blasthome
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__10090__9559&LINK_LOC=blasthome
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__10116__10621&LINK_LOC=blasthome
and with the so-called "microbes" a nucleotide sequence can NEVER be a whole so-called "genome" - THAT is also an impertinent lie!!
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=MicrobialGenomes
And to make the fraud even more efficient, these criminals have now designed a so-called BLAST core_nt, where these designed computer software sequences are fixed stored(from the beginning - the creation of this fraudulent BLAST)) in order to deceive and defraud people again!!!! These experiments in vitro and in silico have ABSOLUTELY NOTHING to do with reality!!!!
Never fall for these fraudulent experiments and tests again!!!!
These toxic-chemical and poisonous substances have been injected into people through lies, manipulation, deception and constantly pushed fear, often with threats of violence and psychological coercion, in order to now constantly push fictitious "viral diseases"
https://phmpt.org/wp-content/uploads/2021/11/5.3.6-postmarketing-experience.pdf (from page 30)
- no one can blame the people themselves, they are all punished enough - cohesion is now important!!!
But it is also important in my opinion that if you know someone has had a booster or a new "vaccination", you should make sure that you don't get too close or have skin contact or get intimate with them for 2-3 weeks - well, that's just a fact - because everyone must assume that this danger will continue to emanate from every substance in the future (regardless of which company produces this poison!)!
https://web.archive.org/web/20210308053257/https://cdn.pfizer.com/pfizercom/2020-11/C4591001_Clinical_Protocol_Nov2020.pdf (Pages 67-69)
8.3.5. Exposure During Pregnancy or Breastfeeding, and Occupational Exposure
Exposure to the study intervention under study during pregnancy or breastfeeding and occupational exposure are reportable to Pfizer Safety within 24 hours of investigator awareness.
8.3.5.1. Exposure During Pregnancy
An EDP occurs if:
β’ A female participant is found to be pregnant while receiving or after discontinuing study intervention.
β’Β A male participant who is receiving or has discontinued study intervention exposes a female partner prior to or around the time of conception.
β’ A female is found to be pregnantΒ while being exposed or having been exposed to study intervention due to environmental exposure. Below are examples of environmental exposure during pregnancy:
β’ A female family member or healthcare provider reports that she is pregnant after having beenΒ exposed to the study intervention by inhalation or skin contact.
by inhalation or skin contact.
β’Β A male family member or healthcare provider who has been exposed to the study intervention by inhalation or skin contact then exposes his female partner prior to or around the time of conception.
A male family member or healthcare provider who has been exposed to the study intervention by inhalation or skin contact then exposes his female partner prior to or around the time of conception.
HEΒ IS EXPOSED BY INHALATION OR SKIN CONTACTΒ AND THEN HEΒ EXPOSES HIS PARTNER BY INHALATION OR SKIN CONTACT - AND OF COURSE, LOGICALLY, EVERYONE ELSE TOO!!!!
And the highly criminal thing about it was and is the fact that nobody will also know in the future how high the poisoning will be!!
https://howbad.info/ (Craig also believes in a fictional "virus", so he has content in it from people who have pushed this tall tale, but despite all that, he's done a really good job!)
https://howbad.info/pfizertoxicity.pdf
https://howbad.info/underreporting.pdf
PLAYING GOD: An Investigation into UK Medical Democide "Murdered By The State!"
https://rumble.com/v566jy4-playing-god-an-investigation-into-uk-medical-democide-murdered-by-the-state.html
And THAT was and is not just in the UK, but worldwide!!!
Nobody should forget the role of the highly criminal WHO and all the other soulless devils in infertility and abortions in the past!!!
https://www.jerrywdavis.com/wp-content/uploads/HCGfoundinWHOTetanusVaccineinKenya.pdf
https://web.archive.org/web/20240000000000*/https://www.jerrywdavis.com/wp-content/uploads/HCGfoundinWHOTetanusVaccineinKenya.pdf
And that the WHO (including the UN, IMF, WEF etc. - governments, MSM, etc. etc.) is a criminal and corrupt gang that has NEVER had anything to do with the health of mankind should also be clear to everyone - money and power is the only thing these soulless Subjects have always wanted - now must be the time to end THAT with a clear, self-confident and irrevocable NO from the people themselves!!!!
Let's NEVER again give anyone the chance to hurt and kill us all and especially our children!!!!
With respect, appreciation and recognition of the individuality of every single person in this world!!!β€οΈβ€οΈβ€οΈ
Its been too long since I first heard that Blind Joe song. Thank you for spotlighting it. Did my heart good to hear it. Speaking of heart... I can't begin to describe what the last four plus years has done to my 7.5 decades old heart. Beginning in March 2020 I sounded the alarm bells of verbal warnings to all my loved ones. I tried to tell them what was/is really going on and I pleaded with them to not fall prey to the lies, the fear mongering and death chants. I begged them all, my sons and daughters and closest friends, old and new, not to take the jabs. All but one of the dozens, ignored my pleas, heckled, chastised, and berated me as they got on that death vaxx train with their children, my grandchildren, in tow. They cared not that their 96 y.o. grandmother was imprisoned in the nursing home by the 'Mandates' and could no longer receive my visits and hugs and stories, and I Love You's. They cared not that the death jabs were given to another of my loved ones who had Alzheimer's. They were blinded, and still are, by the fear of death and the fear of truth. They lost hold of self respect and self esteem, and it seems they may be shackled forever to ride the death rails of compliance. My heart breaks for my loved ones and all those billions who caved, who acquiesced to the psyop of all psyops. A War the likes of which humankind has ever known. Some will make it through. Not me, I'm just an old warrior with not much time left. Those who make it out to the other side of this hell on earth, this War of all Wars, will wish they could, but will never forget. I pray every day and the Creator gives me some peace, some assurance when I am overcome with grief and aloneness. The time, the day will come to stand my ground again. I will not go quietly. I have not, and will never comply.
I'm not sure why I felt led to respond on this day, with my rant, my quiet rage, on your 'stack', Mary-Ann. Thank you again for the song, for your writing.
May God Bless you in all ways and always.
You are not wrong in describing Tedros like that. He was the Minister of Health in Ethiopia. He carried out a massacre in his country, denounced for his serious human rights violations and for a severe humanitarian crisis. And he is chosen to preside over the WHO. Are we in a world ruled by the beast or not?
I love that final video, I also shared it at the time.