When you see such numbers, they are deposited Accession Numbers of
so-called samples/nucleotide sequence accession numbers and this are NOT so-called "virus strains"!!!!
The scientific fraud begins with the search for a so-called "virus",
generated on the computer, with a stupid test that must be abolished
100% and that NOBODY should do anymore, as it only serves to steal
your DNA, your absolutely very personally property!!!!
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__9606__9558&LINK_LOC=blasthome
And this science fraud is what these clowns have always been doing!!!
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1489438/table/t1/?report=objectonly -
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1489438/
This fraud has been going on for a very long time, as you can also see e.g. here:
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC249319/pdf/jvirol00059-0400.pdf
GGCACCCTGGAGTTTATCAA
ATGATGTGCCGGATTATGCC
TCCCTTAGGTCACTAGTTGC
GCGTATTTTGAAGTAACCCCG
CCTGGGACATGCCCCATATG
GTCCCTACGCCTTACATGGT
____________________________________________________________________
This all happens in synthetic and chemical treated, prepared cell lines/cultures(Vero 6) https://sigmaaldrich.com/AT/en/product/sigma/cb_85020206 in vitro and has NOTHING to do with humans and THAT is NOT isolation, it's bullshit!!!!
And then they use additional substances to kill cell material
and here it becomes absolutely idiotic:
https://cls.shop/HuH7/300156
“HuH-7 cells are a type of epithelial-like, ‼️tumorigenic cell line initially taken from a liver tumor in a 57-year-old Japanese male in 1982. ‼️The term "HuH-7" stands for human hepatoma, and these cells have become a well-established and differentiated hepatocyte-derived cellular carcinoma cell line. The human hepatoma-derived HuH-7 cell line and its derivatives have been widely used in research as a convenient experimental substitute for primary hepatocytes. In particular, they have been instrumental in hepatitis C research and used as host cells for ‼️propagating the virus :-) in vitro.‼️ HuH-7 cells have played a crucial role in hepatitis C research, especially when it comes to drug development. Prior to 2005, researchers were unable to cultivate the hepatitis C virus in the laboratory, making it difficult to test potential drug candidates against it. The introduction of the HuH-7 cell line changed that. These cells are highly permissive to the replication of the hepatitis C virus, making them ideal for in vitro testing. By using the HuH-7 cells, researchers were able to screen drug candidates against laboratory-grown hepatitis C, which paved the way for the development of new drugs to fight the virus. Unlike other established human hepatoma cell lines, HuH-7 cells can be propagated in a chemically defined medium containing trace amounts of selenium in place of serum. This allows for systematic studies of ‼️the in vitro effects‼️ of various compounds on their growth and metabolism. Most HuH-7 cells have a chromosome number between 55 and 63 and typically grow as 2D monolayers. The growth medium for HuH-7 cells should be renewed 2-3 times a week or as needed according to the media pH, and cell confluency should be maintained between 30 to 90%. The doubling time of these cells is 24 to 50 hours. In comparison to HepG2 cells, which have been commonly used as a model for the study of synthesis and secretion of human apoB-100, Huh-7 cells were adopted as an alternative model with the assumption that they would be superior in some respects of lipoprotein metabolism, including VLDL secretion. However, it was found that Huh-7 cells did not offer any advantages over HepG2 cells as a general model of human apoB100-lipoprotein metabolism.” :-) :-)
Now let's see what these clowns find with prepared cell lines and a idiotic test:
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6060086/ - with primers,
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6060086/table/tbl0005/?report=objectonly
which in turn find only dead cell debris, as there has NEVER been an HPV!!!
Enter each group of letters into the BLAST-Research at Enter Query Sequence, scroll down to the blue box on the left, click on it and wait for the result!
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__9606__9558&LINK_LOC=blasthome
….as well as fluorescent agents for the electronic light microscope, through these agents an additional dehydration takes place
https://maryann255.substack.com/p/the-truth-is-always-on-the-other-b7c
which also cause cells to die and change(in addition, the human being excretes millions of dead cells every day through regeneration/cell division) - then these clowns look for these dead cells/nucleotide-sequences with an idiotic PCR test and it is the same with all the other invented fictitious "viruses" and enter the nucleotide sequences into the computer - none of this has anything to do with reality and to claim, that these Nucleotide-sequences would be an "mRNA" or a "virus" is nonsense!!