THE TRUTH IS ALWAYS ON THE OTHER SIDE
Remeber BLAST Research: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__9606__9558&LINK_LOC=blasthome
Primer and probe sequences for the duplex real-time RT-PCR for EEEV and WEEV from: A duplex real-time reverse transcriptase polymerase chain reaction assay for detecting western equine and eastern equine encephalitis viruses
https://virologyj.biomedcentral.com/articles/10.1186/1743-422X-7-284/tables/1
Development of a Real-Time Reverse Transcriptase PCR Assay for Type A Influenza Virus and the Avian H5 and H7 Hemagglutinin Subtypes
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC130722/
and "TAMRA" can be omitted from the letters group, because it is only a fluorescence enhancing agent - also "FAM", which is also a fluorescent agent - and also BHQ-1!
https://www.interchim.fr/ft/5/52498A.pdf
https://probes.bocsci.com/fluorophore/fluorescein-fam.html
https://shop.biosearchtech.com/nucleic-acid-chemistry-reagents-and-instruments/modified-oligo-synthesis-reagents/fluorophores-and-quenchers/bhq/bhq-1-amidite/p/NACI6-008
https://www.jenabioscience.com/molecular-biology/real-time-pcr-qpcr/dual-labeled-fluorescent-probes/bhq-1-quencher
BHK-21 cells are a preperated cell line used to search for alleged and fictitious "viruses" to commit scientific fraud and to lie and deceive people!!!
https://www.sigmaaldrich.com/AT/en/product/sigma/cb_85011433
and here you can also buy the other foreign substances as ready-made products to dehydrate cells and make them die, to achieve the so-called cytopatic effect(CPE)!
https://www.atcc.org/products/ccl-10
A film from Harold Hillman on the effects of staining on cells and the addition of foreign substances - and you can witness how cells change, become dehydrated and of course eventually die off as well, since they do not return to their normal state.
https://big-lies.org/media/hillman-1987-effects-of-staining-timer-720x576.mp4
And if more people had read Harold Hillman’s “An Indictment of Modern Cell Biology” paper
https://big-lies.org/harold-hillman-biology/A%20Serious%20Indictment%20of%20Modern%20Cell%20Biology.pdf
(or the other books) which concisely summarises his life’s work, NO PEOPLE would believe anything that they were told today and the last decades . Any supposed sub-cellular mechanism that explains anything is more than likely NONSENSE.
https://big-lies.org/harold-hillman-biology/index.html
And these clown virologists, who want to explain so-called viruses with these methods and thus commit an absolute scientific fraud, all belong locked away - without exception - they all deceive people to their disadvantage!!!
Now a little about the "Cell Culture HEK 293 Cell Line"
https://www.thermofisher.com/at/en/home/references/gibco-cell-culture-basics/cell-morphology/morphology-of-293-cells.html
We can read: "The HEK293 cell line is a permanent line established from primary embryonic human kidney, which was transformed with sheared human adenovirus type 5 DNA. The adenoviral genes expressed in this cell line allow the cells to produce very high levels of recombinant proteins. We offer several variants of the HEK293 cell line, including those adapted for high-density suspension culture in serum-free media."
It's just that the "sequences" of the so-called "Adenovirus Type 5 DNA" are themselves already parts of the human genome - therefore also NOT a virus!!!
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC343247/pdf/nar00485-0303.pdf
CCCCGCACCCTTGCCCCGCCCACTG
CTCAAACACTGCACCGCG
CTAACTTCGGTTATACTATTACTCCCCCAC
AATAAAACGTAGTAGTTATTATATGG
or here:
https://ch3biosystems.com/product/hek293-cell-line/
We can read: "Formulation:
25 to 50 X 106 cells in flask containing RPMI 1640 culture medium and 5% fetal bovine serum or frozen cell pellet in cryoprotectant." - and "Testing:
Cultured on tissue culture plastic in 5% fetal bovine serum with either DMEM or RPMI 1640."
What is e.g. DMEM?
https://www.thermofisher.com/at/en/home/life-science/cell-culture/mammalian-cell-culture/cell-culture-media/dmem.html
We can read: "DMEM composition: Dulbecco's Modified Eagle Medium contains four times the amino acid and vitamin concentration of original Eagle's Minimal Essential Medium. The original DMEM formulation contained a low concentration of glucose (1 g/L) and sodium pyruvate. However, DMEM is now available in a variety of formulations, including those with higher glucose levels and with or without sodium pyruvate. DMEM also uses a sodium bicarbonate buffer system, allowing for maintenance of physiological pH in a 5–10% CO2 environment. Importantly, DMEM commonly requires fetal bovine serum (FBS) supplementation.
Fetal Bovine Serum (FBS)
https://www.thermofisher.com/at/en/home/life-science/cell-culture/mammalian-cell-culture/fbs.html
"Fetal bovine serum (FBS) is a byproduct of harvesting cattle for the meatpacking industry–it offers essential growth factors for the maintenance and growth of cultured cells. FBS is used as a supplement to basal growth medium in cell culture applications."
etc. etc. etc.
Well, do you all understand now that simply EVERYTHING is artificially brought about, that everything is a lie and a fraud and has absolutely NOTHING to do with reality??!!!!
And if you look a little closer here
https://www.who.int/docs/default-source/coronaviruse/wuhan-virus-assay-v1991527e5122341d99287a1b17c111902.pdf?sfvrsn=d381fc88_21
you discover that as a "positive sample" for the "new fictitious virus" the "sequences from the old fictitious "SARS virus" are listed - and these so-called "sequences", as we already know, are just parts of the human genome, the mouse, the rat and the plants - and this is the same for all conjured up "viruses" - Drosten and his cronies including the WHO should be locked in a deep hole forever!!!! The only way to get out of this crime again is that as many people as possible together stay away from all regulations, surveillance regulations, the lying press, the toxic Gene-Substances etc., help each other together if necessary and build a new world/reality where there is a togetherness and never again a against each other!!!! Try to communicate this to your fellow men and get as many people as possible in this saving boat to enable the children and grandchildren again a free future!!!! Because without us humans as extended arms for the execution of the murderous thoughts and deeds of these criminals, these devils are powerless and only more ridiculous - never forget that more!!!!