THE TRUTH IS ALWAYS ON THE OTHER SIDE
1.
It is the greatest crime against humanity and a mass murder, because these so-called "nucleic acid snippets/sequences" were already in the community in 2018 and 2019(and if we were to go back further, this would also be the case)
https://www.sciencedirect.com/science/article/pii/S0048969720352402?via%3Dihub
https://www.sciencedirect.com/science/article/pii/S0048969721012651?via%3Dihub
I can't read all this BULLSHIT anymore > “Methodology” > an idiocy where I simply can't think of any more suitable adjectives!!!
(and at that time there was still freedom of travel for everyone, no dirty, harmful masks, no unscientific and idiotic tests, no distance, nothing, nobody cared it), then according to the relevant literature, what I've heard on the Uni and what has been communicated to people for almost 200 years, there should already be millions of harmless so-called "variants" - and consequently there can not be the same "nuclein acid snippets/so-called sequences" every year - THAT should actually be logical!!!!
CONCLUSION: 1. NO SO-CALLED "VIRUS", but the logical elimination of dead cell debris, which is enormously important to maintain health!!! 2. the WHO has deliberately lied, as they have already done in 2009
https://www.bmj.com/content/bmj/340/7759/Feature.full.pdf?fbclid=IwAR1jViLItUaFchUNOfAz0zk2Kz9ZyaWCXQLm3xws4Bt0lbCyt9ZePZfxcI8
(this organization serves exclusively its sponsors and the pharmaceutical lobby, but NOT the people!!) and all governments and their parties including the so-called "experts", confused "virologists", "scientists", doctors, media paid with tax money/the lying press etc. etc. have adopted this lie unchecked, partly perhaps unknowingly, but mostly deliberately and arbitrarily and since this lying and this fraud has been going on for almost 3 years by now, no one can make excuses here anymore!!!!
Now let us make the proof:
https://docs.google.com/spreadsheets/d/1uNoijuXDg5tzstEuaxtOrYv3fZ0Nyc405_thJY4-BBg/edit?fbclid=IwAR3pk8xILp8TMpGOwcXDaEIBpMILl-DjabPms3c9zati_Wfi__mq7khJ83c#gid=0
Ladies and gentlemen, let us prove once that everything was a lie from the beginning and it concerns clearly human cell debris - in addition you take this side:
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__9606__9558&LINK_LOC=blasthome
- then you enter with -Enter Query Sequence- e.g. for Germany the so-called "E-gene", which you can see here (simply copy):
ACAGGTACGTTAATAGTTAATAGCGT
- then scroll down until you find on the left side in the blue box the word BLAST, there you press it and wait until you have the results - it appears on the top right -Filter Results-, then you can scroll down again and will see that the so-called fictitious "virus sequences" are particles of the human genome,
which can NEVER infect anyone else and when they are dead MUST be excreted, so that the organism remains healthy (yes, and sometimes this is also connected with illness(eldery peoples), especially when someone has already been taking medications for years (these always contain toxic substances that have side effects, but also through the so-called "vaccinations" etc., which firstly are NOT necessary and secondly damage the organs) -
Conclusion: EVERYTHING was a lie and a fraud from the beginning and the same happens every year with the so-called fictitious "flu viruses" - this is also an absolute lie again and again! Here are the individual letter groups of influenza A listed
https://ncbi.nlm.nih.gov/pmc/articles/PMC33681/ ,
enter each one in the BLAST
e.g. CAGTATGTCTCCCGGTTT
search and these are also cell debris from humans
and NOT a so-called "virus"!!!!
1. REMEMBER one thing: "We will NEVER forget or forgive this high crime until you are all there, where criminals belong!!!!
Neurons line your nose and tell your brain how to interpret the chemical information that makes up a smell. Damage to these neurons changes the way smells reach in your brain. The olfactory bulbs underneath the front of your brain receive signals from these neurons and give your brain a signal about the scent: whether it’s pleasing, enticing, appetizing, or foul. These olfactory bulbs can be damaged, which can cause parosmia. exposure to toxic chemicals and high volumes of air pollution can cause parosmia to develop. But you must think and not forget the nasal swabs!!
https://thereisnopandemic.net/2021/03/14/dr-andrew-kaufman-on-the-deep-nasal-swab-taken-for-the-pcr-test/
- https://principia-scientific.com/why-you-should-refuse-your-employers-regular-pcr-nasal-swabs/
- https://rumble.com/vvyz0l-dr.-jos-luis-gettor-on-the-presence-of-ethylene-oxide-and-graphene-oxide-in.html?mref=6zof&mc=dgip3&utm_source=newsletter&utm_medium=email&utm_campaign=ORWELLITO&ep=2
- https://www.pearl-hifi.com/11_Spirited_Growth/10_Health_Neg/04_Pandemics/05_COVID_19/Analysis_of_test_sticks_from_surface_testing_in_the_Slovak_Republic.pdf
- forgotten victims: countless people suffering adverse effects after PCR nasal swab “tests”
https://thecovidblog.com/2022/04/19/forgotten-victims-countless-people-short-long-term-effects-deauthorized-pcr-nasal-swab-tests/
READ IT ALL CAREFULLY!!!!
No one will escape the just consequence of his actions and thoughts! Definitely no one!
There you can still wriggle so miserable as wretches, whining, complaining, yelling, pretending to be “oh so poor victims” and arguing as you want, saying that fortunately it might not be so bad in the end and you would not have known and would not have understood this biggest lie, manipulation and high criminal fraud in the history of mankind....
...you nursery teachers and teachers, who have ruthlessly forced masks on the youngest and most innocent of all, ruthlessly and cruelly, inhumanly stabbed them with swab-sticks in their noses and mouths, raped them physically, mentally and emotionally with meaningless PCR tests, told them that they would kill their grandparents if they got too close to them because they had bugs on their fingers.... you nurses and doctors, who have done the same to our children... and with the old people in the hospitals and nursing homes, even on their deathbed, in their last hour, you all committed the same crimes against them, condescending, haughty, arrogant, brutal, ruthless inhuman, just stupid - that you all killed the old people with completely useless and unnecessary experimental drugs, aggressive ventilation, fear and isolation from the beginning - you all don't want to have known this?.... you governments, politicians, provincial governors, mayors, district chiefs, so-called idiotic "fact-checkers", mainstream media, so-called "experts", civil servants, police officers, who initiated and supported all this, ordered it, created laws for this crime, abolished the basic rights, liberties and personal rights, who condemned, denounced and blamed the self-thinkers and warners for the lying pandemic, who persecuted them, ostracized them, did violence to them, coerced them, punished them, locked them up and put them away, and who were thus jointly responsible for what was done to our youngest and oldest and everyone else... YOU ALL are an absolutely shame for the global world and now YOU want to ask for forgiveness and to put all your crimes as harmless or not so bad or that you've not known, that there has NEVER been even a spark of a health pandemic? That there has been (and still is) only one pandemic, namely only a PANDEMIE of LIES and FRAUD... You can't escape the facts and the truth and for this there can and will never, NEVER be even a hint of an apology or forgiveness and forgetting!!! All these crimes can be punished only by a hard punishment - and once again: Mass murderers have no right to freedom, NEVER!!!!
Those who have been on the streets for almost 3 years have known all this very well, because they've listened to their hearts and thought outside the box.
In this sense and all the more with my very best greetings and wishes to all the wonderful and brave people who have been going out on the streets to enlighten and inform, who have stood up for the truth so nobly, selflessly and still do. You are the true heroes and the people that humanity needs, for a better world.
And for you all: DON'T LET GIVE NO MORE POISON IN YOUR BODY!!!! - Video: The “Death Tsunami” Is Here. “You should never ever take any Covid shot anymore”. Dr. Sherry Tenpenny
https://globalresearch.ca/video-death-tsunami-here-dr-sherry-tenpenny/5798390
- This cautioning also applies to simple flu shots, or combinations of flu-Covid shots – which are now being marketed. Because all these shots – “they” don’t tell you – will contain killer formulas.‼️‼️‼️‼️‼️‼️‼️‼️
https://graphene-flagship.eu/graphene/news/grapheal-uses-graphene-sensors-connected-to-smartphones-for-biomedical-applications/
....and then there are still people who believe that graphene(we know, how toxic Grafen for the whole body is
https://particleandfibretoxicology.biomedcentral.com/articles/10.1186/s12989-016-0168-y )
would have nothing to do with a bluetoothsignal and that this is in no way used(the date here is the published, but of course this was already used in these contaminated and toxic substances and also proven
https://orwell.city/2021/08/nanoprocessor.html
- after all, one had to practice a little with the people as guinea pigs and will continue to do so. ...) well, there must be finally also gullible and ignorant, otherwise these criminals would not have such an easy game with mankind... but hey, we who warn you all the time, we are all absolutely stupid, aren't we?
sciencedirect.com/science/article/abs/pii/S1748013219306929
for a thinking person it's clear, that THIS serves to take away people's free will and modulate them into emotionless, non-self-reliant, memoryless objects/slaves.... an absolute horror!!!
https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020060606 https://blog.nomorefakenews.com/2021/09/17/the-real-lab-leak-story-nanotech-crimes/
- and if it kills a few million or even billions, who cares... people will no longer be able to control their brains.... an immense danger to all!! Read this about Charles Lieber: